View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20055_high_8 (Length: 330)
Name: NF20055_high_8
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20055_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 292
Target Start/End: Original strand, 52400322 - 52400596
Alignment:
| Q |
18 |
cagagagtgatcctttggctagaaatattaactcgtatcgtgttcgtatatcattgattaataatattaagtttgcagggggatctgtataatcatgaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52400322 |
cagagagtgatcctttggctagaaatattaactcgtatcgtgttcgtatatcattgattaataatattaagtttgcagggggatctgtataatcatgaga |
52400421 |
T |
 |
| Q |
118 |
acttggtgaaagcaatcaagcaggtagatgtggtcatatctacggtaggccacgctcagattgaggatcaagtgaagattatcgctgcaattaaggaggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52400422 |
acttggtgaaagcaatcaagcaggtagatgtggtcatatctacggtaggccacgctcagattgaggatcaagtgaagattatcgctgcaattaaggaggc |
52400521 |
T |
 |
| Q |
218 |
tggtaacgttaaggttgtcattttcattctttataattcaggacactatctttgaaagttttagtgccttttacc |
292 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
52400522 |
tggtaatgttaaggttgtcattttcattctttataattcaggacacaatctttgaaagtttcagtgccttttacc |
52400596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 92 - 158
Target Start/End: Original strand, 52407218 - 52407284
Alignment:
| Q |
92 |
gcagggggatctgtataatcatgagaacttggtgaaagcaatcaagcaggtagatgtggtcatatct |
158 |
Q |
| |
|
|||||||||||| || || |||||| ||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
52407218 |
gcagggggatctctacgataatgagagcttggtgaaagcaatgaagcaggtagacgtggtcatatct |
52407284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University