View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20055_low_11 (Length: 311)
Name: NF20055_low_11
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20055_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 157 - 296
Target Start/End: Original strand, 49202266 - 49202405
Alignment:
| Q |
157 |
agtatgattcaagtaacacaagttactggcttatgtttattttttggatgtactagttacgatgcaagctcaacgcacggcaccgcctgatatgcattgc |
256 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49202266 |
agtatgattcaagtaacacaagttattggcttatgtttattttttggatgtactagttacgatgcaagctcaacgcacggcaccccctgatatgcattgc |
49202365 |
T |
|
| Q |
257 |
aaagacaagtttcttattataagcactgttgtcccctttg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49202366 |
aaagacaagtttcttattataagcactgttgtcccctttg |
49202405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 49202112 - 49202231
Alignment:
| Q |
1 |
acgtcgccgaagaagtactgcgttagacctaatataggcatcatcaagccaaaggataaatgtgatttcactggtannnnnnncatttaccttcttgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49202112 |
acgtcgccgaagaagtactgcgttagacctaatataggcatcatcaagccaaaggataaatgtgatttcactggtatttttttcatttaccttcttgttt |
49202211 |
T |
|
| Q |
101 |
aaggctcaattcatttcata |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49202212 |
aaggctcaattcatttcata |
49202231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University