View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20055_low_12 (Length: 288)
Name: NF20055_low_12
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20055_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 23 - 254
Target Start/End: Complemental strand, 4075154 - 4074923
Alignment:
| Q |
23 |
aagtgaaaaggtatatggaaataaaatgagatgacaattcttgatgaatcgagaaattttaagttgtggggacaatactcgtatagtttgtaaagtacga |
122 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
4075154 |
aagtgaaaaagtatatggaaataaaatgagatgacaaatcgtgatgaatcgagaaattttaagttgtggggacaatacacgtatagtttgtaaagcacga |
4075055 |
T |
 |
| Q |
123 |
gtttatctgacttttaatcgggcaaattgctctaatatctactgagttgggtccactatgttgtgaccagatttgaaattacagataaatcatggccaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4075054 |
gtttatctgacttttaatcgggcaaattgctctaatatctactgaattgggtccactatgttgtgaccagatttgaaattacagataaatcatggccaac |
4074955 |
T |
 |
| Q |
223 |
ctagagtttggcaaaccaaaggttgtttacaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4074954 |
ctagagtttggcaaaccaaaggttgtttacaa |
4074923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University