View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20055_low_19 (Length: 232)

Name: NF20055_low_19
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20055_low_19
NF20055_low_19
[»] chr6 (3 HSPs)
chr6 (7-110)||(11437166-11437265)
chr6 (157-220)||(11437312-11437375)
chr6 (42-102)||(11429889-11429949)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 4e-37; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 11437166 - 11437265
Alignment:
7 gcagcagagatatcaacatttttgacgtcgcggtgtaaattgtggttgccaacatttttcaaaaccttgatatgcactctaacatgcttaactcatatct 106  Q
    |||||||||| |||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||| |||    
11437166 gcagcagagacatcaacatttttgacgtcgcggtgtaaattgtg----ccaacatttttcaaaaccttgatatgcactctaacatgcttaactcatttct 11437261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 11437312 - 11437375
Alignment:
157 ctctatctattaacacacatggaatttgannnnnnnnngacataccaatggatctttttcaatg 220  Q
    |||||||||||||||||||||||||||||         |||||||||||||||||||| |||||    
11437312 ctctatctattaacacacatggaatttgaattttttttgacataccaatggatcttttgcaatg 11437375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 102
Target Start/End: Original strand, 11429889 - 11429949
Alignment:
42 taaattgtggttgccaacatttttcaaaaccttgatatgcactctaacatgcttaactcat 102  Q
    ||||| ||| |||| ||| ||||||||||||||||| |||||| || ||||||||| ||||    
11429889 taaatggtgtttgcaaacctttttcaaaaccttgatgtgcactttagcatgcttaattcat 11429949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University