View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20055_low_19 (Length: 232)
Name: NF20055_low_19
Description: NF20055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20055_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 4e-37; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 11437166 - 11437265
Alignment:
| Q |
7 |
gcagcagagatatcaacatttttgacgtcgcggtgtaaattgtggttgccaacatttttcaaaaccttgatatgcactctaacatgcttaactcatatct |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
11437166 |
gcagcagagacatcaacatttttgacgtcgcggtgtaaattgtg----ccaacatttttcaaaaccttgatatgcactctaacatgcttaactcatttct |
11437261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 11437312 - 11437375
Alignment:
| Q |
157 |
ctctatctattaacacacatggaatttgannnnnnnnngacataccaatggatctttttcaatg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
11437312 |
ctctatctattaacacacatggaatttgaattttttttgacataccaatggatcttttgcaatg |
11437375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 102
Target Start/End: Original strand, 11429889 - 11429949
Alignment:
| Q |
42 |
taaattgtggttgccaacatttttcaaaaccttgatatgcactctaacatgcttaactcat |
102 |
Q |
| |
|
||||| ||| |||| ||| ||||||||||||||||| |||||| || ||||||||| |||| |
|
|
| T |
11429889 |
taaatggtgtttgcaaacctttttcaaaaccttgatgtgcactttagcatgcttaattcat |
11429949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University