View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20056_low_12 (Length: 403)
Name: NF20056_low_12
Description: NF20056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20056_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 7 - 273
Target Start/End: Complemental strand, 31245459 - 31245193
Alignment:
| Q |
7 |
tgaaatgaaagaagagtggcatgaagctaataataccttcagaccaccaccaactggtctttccccggctgaaattcgaagtctatgctgctttctcttg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31245459 |
tgaaatgaaagaagagtggcatgaagctaataataccttcagaccaccaccaactggtctttccccggctgaaattcgaagtctacgctgctttctcttg |
31245360 |
T |
 |
| Q |
107 |
aaattcttccttgccagtatggtcggtagctttctcatatgtttgcttttagacttagcacgtaattaaggaacatgattgaggatttgtagacaaacct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31245359 |
aaattcttccttgccagtatggtcggtagctttctcatatgtttgcttttagacttagcacgtaattaaggaacatgattgaggatttgtagacaaacct |
31245260 |
T |
 |
| Q |
207 |
gtgatcattataaattttataaacacaggtaccaaacataaatatctcgcatatttttatgcaacct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31245259 |
gtgatcattataaattttataaacacaggtaccaaacataaatatctcgcatatttttatgcaacct |
31245193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 272 - 389
Target Start/End: Complemental strand, 31245152 - 31245031
Alignment:
| Q |
272 |
cttgcgttaactgttttttattcgagtcttct----ttggttatgaatggattgtcatttgacatgtagagaacagaaacaaagatttgtgaacatgcat |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31245152 |
cttgcgttaactgttttttattcgagtcttctcattttggttatgaatggattgtcatttgacatgtagagaacagaaacaaagatttgtgaacatgcat |
31245053 |
T |
 |
| Q |
368 |
tgtgttgaggaaatgaaccaag |
389 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31245052 |
tgtgttgaggaaatgaaccaag |
31245031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University