View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20056_low_6 (Length: 446)
Name: NF20056_low_6
Description: NF20056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20056_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 102 - 285
Target Start/End: Complemental strand, 41787563 - 41787380
Alignment:
| Q |
102 |
ccgatgtcacatgtgtgtgtaaacataggactagttgcaaatgcatgtggctctacagtaacttcagtatgtccattcttgaggaagaatcatatcattc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41787563 |
ccgatgtcacatgtgtgtgtaaacataggactagttgcaaatgcatgtggctctacagtaacttcaatatgtccattcttgaggaagaatcatatcattc |
41787464 |
T |
|
| Q |
202 |
tggacttctgttgctgcttttgttgacgggtgattctcaagtgaaaacataccttccctatggttcaaaacaatatctgcaaat |
285 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41787463 |
tggacttctgttgctgcttttgttgactggtgattctcaagtgaaaacataccttccctatggttcaaaacaagatctgcaaat |
41787380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 286 - 434
Target Start/End: Complemental strand, 41787356 - 41787208
Alignment:
| Q |
286 |
agcaaattgattcacaaaaaatagatgaaaatcaaattagatagttttatattcataatcaataactgtcagttcaatactatagaactagttggcgaca |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787356 |
agcaaattgattcacaaaaaatagatgaaaatcaaattagatagttttatattcataatcaataactgtcagttcaatactatagaactagttggcgaca |
41787257 |
T |
|
| Q |
386 |
aattgctagttgatagcaccaagtatttggactgttggaataaattgca |
434 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
41787256 |
aattgctagttgatagtaccaagtatttggaccgttggaataaattgca |
41787208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University