View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20057_high_24 (Length: 305)
Name: NF20057_high_24
Description: NF20057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20057_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 35219243 - 35219382
Alignment:
| Q |
1 |
cccttcattacatttacacgttcagttgttatctttaaaccaaacccgaaaacaacagtaccaagtttttgtcattctttgctagaaactatggactcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35219243 |
cccttcattacatttacacgttcagttgttatctttaaaccaaacccgaaaacaacagtaccaagtttttgtcattctttgctagaaactatggactcta |
35219342 |
T |
 |
| Q |
101 |
tcagcacaagtagcaccagttcatcagtgattagtactgt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35219343 |
tcagcacaagtagcaccagttcatcagtgattagtactgt |
35219382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 213 - 290
Target Start/End: Original strand, 35219455 - 35219532
Alignment:
| Q |
213 |
tatcaaggtagtgtacatatcaaaccctatgaaggttaagactagtgcctctgaatttagggcactggtccaagaact |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35219455 |
tatcaaggtagtgtacatatcaaaccctatgaaggttaagactagtgcctctgaatttagggcactggtccaagaact |
35219532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University