View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20057_high_34 (Length: 202)

Name: NF20057_high_34
Description: NF20057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20057_high_34
NF20057_high_34
[»] chr3 (1 HSPs)
chr3 (14-202)||(47035927-47036115)
[»] chr4 (1 HSPs)
chr4 (19-84)||(44495579-44495644)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 14 - 202
Target Start/End: Original strand, 47035927 - 47036115
Alignment:
14 catcaatatcgccctagctagcagacactcgcggagaacatgtaaaattgattcaatttcattaccacaaaaattgcagcacgaatcacctaattgatta 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47035927 catctatatcgccctagctagcagacactcgcggagaacatgtaaaattgattcaatttcattaccacaaaaattgcagcacgaatcacctaattgatta 47036026  T
114 cgcgactttttcaaatcaatgaacagtcttccatgacaaactagccaaataaagtatctaacacgctctggagcatgaattctccaaac 202  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
47036027 cacgactttttcaaatcaatgaacagtcttccatgacaaactagccaaataaagcatctaacacgctctggagcatgaattctccaaac 47036115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 44495579 - 44495644
Alignment:
19 atatcgccctagctagcagacactcgcggagaacatgtaaaattgattcaatttcattaccacaaa 84  Q
    |||||| ||||| |||| |||||||| ||||| ||||||||||||||| |||||| ||||||||||    
44495579 atatcgtcctagttagcggacactcgtggagagcatgtaaaattgattaaatttcgttaccacaaa 44495644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University