View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20057_low_20 (Length: 327)
Name: NF20057_low_20
Description: NF20057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20057_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 33576794 - 33576946
Alignment:
| Q |
1 |
acaaccattttcactaaaatttaaaataatacaggaaactatagagtaatagctcgatggtaagagcttagacttgtaacatactaacattcaagtatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
33576794 |
acaaccattttcactaaaatttaaaataatacagtaaactatagagttatagctcgatggtaagagcttaaacttgtaacatactaacatccaagtatcg |
33576893 |
T |
 |
| Q |
101 |
agttcaaatctcatcgaggtccgttctaaactggtcaacagtgccacttgaat |
153 |
Q |
| |
|
| ||||||||||||||| || ||||||||||||||||| ||||||||||||| |
|
|
| T |
33576894 |
aattcaaatctcatcgaattcagttctaaactggtcaaccgtgccacttgaat |
33576946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 244 - 311
Target Start/End: Original strand, 33577082 - 33577149
Alignment:
| Q |
244 |
aataagcatgaagttttcaactttcaattaatcacttaaacataaatttcttcaaacaaattacaatc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33577082 |
aataagcatgaagttttcaactttcaattaatcacttaaacataaatttcttcagacaaattacaatc |
33577149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University