View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20057_low_36 (Length: 202)
Name: NF20057_low_36
Description: NF20057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20057_low_36 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 14 - 202
Target Start/End: Original strand, 47035927 - 47036115
Alignment:
| Q |
14 |
catcaatatcgccctagctagcagacactcgcggagaacatgtaaaattgattcaatttcattaccacaaaaattgcagcacgaatcacctaattgatta |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47035927 |
catctatatcgccctagctagcagacactcgcggagaacatgtaaaattgattcaatttcattaccacaaaaattgcagcacgaatcacctaattgatta |
47036026 |
T |
|
| Q |
114 |
cgcgactttttcaaatcaatgaacagtcttccatgacaaactagccaaataaagtatctaacacgctctggagcatgaattctccaaac |
202 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47036027 |
cacgactttttcaaatcaatgaacagtcttccatgacaaactagccaaataaagcatctaacacgctctggagcatgaattctccaaac |
47036115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 44495579 - 44495644
Alignment:
| Q |
19 |
atatcgccctagctagcagacactcgcggagaacatgtaaaattgattcaatttcattaccacaaa |
84 |
Q |
| |
|
|||||| ||||| |||| |||||||| ||||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
44495579 |
atatcgtcctagttagcggacactcgtggagagcatgtaaaattgattaaatttcgttaccacaaa |
44495644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University