View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_high_20 (Length: 451)
Name: NF20058_high_20
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 277 - 434
Target Start/End: Complemental strand, 29184121 - 29183965
Alignment:
| Q |
277 |
atgtttaaattcatattgagttagatagaatcacgtcgaattaatataatttttcaaaaattacaagttataa-ttttgtaacatcacgatggttcacca |
375 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||| |
|
|
| T |
29184121 |
atgtttaaattcatattgaattagatagaatcacgttgaatcaatataatttttcaaaaattat--gttataacttttgtaacatcaggatggttcacca |
29184024 |
T |
 |
| Q |
376 |
taattttaacgaacaaaatataatgccaaacatacggtataaaacttatatcatgtact |
434 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
29184023 |
taattttaacgaacacaatataatgccgaacatacggtataaaacttatgtcatgtact |
29183965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 135 - 170
Target Start/End: Complemental strand, 29184264 - 29184229
Alignment:
| Q |
135 |
gaagacagaacaagatgtgtgcaattaattaatctt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29184264 |
gaagacagaacaagatgtgtgcaattaattaatctt |
29184229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University