View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_high_28 (Length: 394)
Name: NF20058_high_28
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 18 - 373
Target Start/End: Original strand, 36851324 - 36851679
Alignment:
| Q |
18 |
acccagcacttaattgatcatcatcaaggaagctattatctgaattatccacttccccttctacaacttttgcagcacatgaagagcaagcaccagccct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36851324 |
acccagcacttaattgatcatcatcaaggaagctattatctgaattatccacttccccttctacaacttttgcagcacatgaagagcaagcaccagccct |
36851423 |
T |
 |
| Q |
118 |
gcatgagtaaggaagatcgatgccttgttcctcggctacgtcaagaatgtactcattatccgggcaggtaagttctttagttccatctggggtaatgagc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36851424 |
gcatgagtaaggaagatcgatgccttgttcctcggctacgtcaagaatgtactcattatccgggcaggtaagttctttagttccatctggggtaatgagc |
36851523 |
T |
 |
| Q |
218 |
ttgaccttgtaagtggccatggcagtgatacgacttccacgtccggccttcacaccaaatagagtttgacccacgttagggaatgctgttaggcttgtgt |
317 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36851524 |
ttcaccttgtaagtggccatggcagtgatacgacttccacgtccggccttcacaccaaatagagtttgacccacgttagggaatgctgttaggcttgtgt |
36851623 |
T |
 |
| Q |
318 |
tcattggctgcctcctgatgaaggaggtgctcaccatggttcctgatagggctgct |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36851624 |
tcattggctgcctcctgatgaaggaggtgctcaccatggttcctgatagggctgct |
36851679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University