View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_high_34 (Length: 366)
Name: NF20058_high_34
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 53983731 - 53983412
Alignment:
| Q |
1 |
acgtgactcattatctagtttttgtgagtatctctttaatttttaagtagagtcattccttacttttaagaaatgaaaatgatctc---ttagaaagcag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53983731 |
acgtgactcattatctagtttttgtgagtatctctttaatttttaagtagagtcattccttacttttaagaaatgaaaatgatctcaacttagaaagcag |
53983632 |
T |
 |
| Q |
98 |
gtgaagatttccaaagaataaaatactattcttgaaggtaagatgtataaaattatttggcaaaatttggtgcaagggatgatcaagagtttgtcattat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53983631 |
gtgaagatttccaaagaataaaatactattcttgaaggtaagatgtataaaattatttggcaaaatttggtgcaagggatgatcaagagtttgtcattat |
53983532 |
T |
 |
| Q |
198 |
gcaagcctcctcgagctttatgtcttatctttctttgcgggtgttgttggagttttggtttttacaatgaaacaaattcattcnnnnnnnngccagagat |
297 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53983531 |
gcaagcctcctccagctttatgtcttatctttctttgcgggtgttgttggagttttggtttttacaatgaaacaaattcatt-aaaaaaaagccagagat |
53983433 |
T |
 |
| Q |
298 |
caagacagatggttgttatat |
318 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
53983432 |
caagacagatggttgttatat |
53983412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University