View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_high_37 (Length: 360)
Name: NF20058_high_37
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 32725968 - 32725625
Alignment:
| Q |
1 |
caggcgattaacctcctttgccgcttccctcggacaaccattttcttttcatcactgcagattagactccgatgaagctttccgtccttctgcattaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32725968 |
caggcgattaacctcctttgccgcttccctcggacaaccattttcttttcatcactgcagattagactccgatgaaactttccgtccttctgcattaaag |
32725869 |
T |
 |
| Q |
101 |
cttgtacgtggagaggctttggttttcaactgcatgctgaatttacctcaccttagttaccgtgcaccggaatcagttgcttcgtttttaaacggagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725868 |
cttgtacgtggagaggctttggttttcaactgcatgctgaatttacctcaccttagttaccgtgcaccggaatcagttgcttcgtttttaaacggagcaa |
32725769 |
T |
 |
| Q |
201 |
aaacgttgaatccaaagcttgtgacgttggttgaagaagaagttggttctgttgttggtgggtttgtggaaaggttcatggactcacttcatcattattc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725768 |
aaacgttgaatccaaagcttgtgacgttggttgaagaagaagttggttctgttattggtgggtttgtggaaaggttcatggactcacttcatcattattc |
32725669 |
T |
 |
| Q |
301 |
agcggtttttgattcattggaggctggttttccgatgcagaacc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725668 |
agcggtttttgattcattggaggctggttttccgatgcagaacc |
32725625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University