View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_high_41 (Length: 337)
Name: NF20058_high_41
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_high_41 |
 | |
|
| [»] scaffold0300 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0300 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 4083 - 3769
Alignment:
| Q |
1 |
tccttggttccagctacttgttttccgtgatattcttaagaaaaccgtcaaaatccacttcttctcttcagtattgcacatcctcgagaaaattggcgct |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
4083 |
tccttgattccagctacttgttttccgtgatgttcttaagaaaaccgtcaaaatcaacttctcctcttcaatattgcacatccttaagaaaaccggcgct |
3984 |
T |
|
| Q |
101 |
gaacttgcagttacaagggaagaccaaatcattgaagcttggaagagtaagaaccctaaatccttaatcatggaacatctttaaccggttcataattgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
3983 |
gaacttgcagttacaagggaagaccaaatcgttgaagcttggaagagtaagaaccctaaatccccaatcatcgaacatccttaaccggttcataactgaa |
3884 |
T |
|
| Q |
201 |
gaccgtcaaaattgaaggtaacaaaatcgaaattcattctcacattctcgttgaagttccgcaaaatttgtgtttcttttaagatattttcattttagag |
300 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
3883 |
gaccgtcaaaatcgaaggtaacaaaatcgaaattcattctcacattctcgttgaagttccgcaaaatttgtgtttctcttaagatatgttcattttagag |
3784 |
T |
|
| Q |
301 |
attgatctggtgtct |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3783 |
attgatctggtgtct |
3769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University