View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_high_42 (Length: 331)
Name: NF20058_high_42
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_high_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 210 - 312
Target Start/End: Original strand, 38938386 - 38938492
Alignment:
| Q |
210 |
atcaatccaaggttgtcttcaaaatggaaactaagtgaactcggtgtaacataaagtgctgacaaaatccaaaaactaa---tatttcaaaatag-agac |
305 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
38938386 |
atcaatccaaggttgtcttcaaaatagaaactaagtgaactcggtgtaacataaagtgctgacaaaatccaaaaactaatagtatttcaaaatagcagac |
38938485 |
T |
|
| Q |
306 |
aagccta |
312 |
Q |
| |
|
||||||| |
|
|
| T |
38938486 |
aagccta |
38938492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University