View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_high_71 (Length: 244)
Name: NF20058_high_71
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_high_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 52685666 - 52685429
Alignment:
| Q |
1 |
tcttctattttacttaaatcatcttctccttattgcatgaggatttgggatttcaatttgaagaagacggtgatttgtgaatttggtaatttacggattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52685666 |
tcttctattttacttaaatcatcttctccttattgcatgaggatttgggatttcaatttgaagaagacggtgatttgtgaatttggtaatttacggattt |
52685567 |
T |
|
| Q |
101 |
taaatcaattgataacatgtcaaaatggtttaatatttcacatctcctacttgtctccnnnnnnntacaactcaacttttctc-atacttaacatccaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
52685566 |
taaatcaattgataacatgtcaaaatggtttaagatttcacatctcctatttgtct-taaaaaaatacaactcaacttttctcgatacttaacatccaaa |
52685468 |
T |
|
| Q |
200 |
actaaaactaacgtaagagaccataatgaccaacatatt |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52685467 |
actaaaactaacgtaagagaccacaatgaccaacatatt |
52685429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 126
Target Start/End: Complemental strand, 6067285 - 6067228
Alignment:
| Q |
69 |
ggtgatttgtgaatttggtaatttacggattttaaatcaattgataacatgtcaaaat |
126 |
Q |
| |
|
|||| |||| |||||||| |||||| ||||| ||||||||||||||||||| ||||| |
|
|
| T |
6067285 |
ggtggtttgagaatttgggaatttagagatttaaaatcaattgataacatgttaaaat |
6067228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University