View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20058_high_76 (Length: 235)

Name: NF20058_high_76
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20058_high_76
NF20058_high_76
[»] chr1 (1 HSPs)
chr1 (1-224)||(1255950-1256173)
[»] chr2 (1 HSPs)
chr2 (61-100)||(8110535-8110574)
[»] chr8 (1 HSPs)
chr8 (127-180)||(36126150-36126203)


Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1255950 - 1256173
Alignment:
1 ccagcaaattatttaagacatggaaaaggcgaaaattcggatttagcaacatgggtgaattcagttgtaagggaagaatggacaggtgaagtgtttgata 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1255950 ccagcaaattatttaagacatggaaaaggcgaaaattccgatttagcaacatgggtgaattcagttgtaagggaagaatggacaggtgaagtgtttgata 1256049  T
101 agaatataatggggacaagaaatggtgaaggtgagatgttgaagcttttgaggattggaatgtattgttgtgagtggagtgttgagagaagatgggattg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||    
1256050 agaatataatggggacaagaaatggtgaaggtgagatgttgaagcttttgaggattggaatgtactgttgtgaatggagtgttgagagaagatgggattg 1256149  T
201 gaaagaagctttggataagattga 224  Q
    ||||||||||||||||||||||||    
1256150 gaaagaagctttggataagattga 1256173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 61 - 100
Target Start/End: Original strand, 8110535 - 8110574
Alignment:
61 tcagttgtaagggaagaatggacaggtgaagtgtttgata 100  Q
    ||||||||||||||||||||||||||||||||||||||||    
8110535 tcagttgtaagggaagaatggacaggtgaagtgtttgata 8110574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 36126150 - 36126203
Alignment:
127 gaaggtgagatgttgaagcttttgaggattggaatgtattgttgtgagtggagt 180  Q
    |||||||||||||||||||| |||||||||||||||  ||||||||| ||||||    
36126150 gaaggtgagatgttgaagctgttgaggattggaatgagttgttgtgaatggagt 36126203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University