View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20058_low_20 (Length: 451)

Name: NF20058_low_20
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20058_low_20
NF20058_low_20
[»] chr6 (2 HSPs)
chr6 (277-434)||(29183965-29184121)
chr6 (135-170)||(29184229-29184264)


Alignment Details
Target: chr6 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 277 - 434
Target Start/End: Complemental strand, 29184121 - 29183965
Alignment:
277 atgtttaaattcatattgagttagatagaatcacgtcgaattaatataatttttcaaaaattacaagttataa-ttttgtaacatcacgatggttcacca 375  Q
    ||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||   ||||||| ||||||||||||| ||||||||||||    
29184121 atgtttaaattcatattgaattagatagaatcacgttgaatcaatataatttttcaaaaattat--gttataacttttgtaacatcaggatggttcacca 29184024  T
376 taattttaacgaacaaaatataatgccaaacatacggtataaaacttatatcatgtact 434  Q
    ||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||    
29184023 taattttaacgaacacaatataatgccgaacatacggtataaaacttatgtcatgtact 29183965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 135 - 170
Target Start/End: Complemental strand, 29184264 - 29184229
Alignment:
135 gaagacagaacaagatgtgtgcaattaattaatctt 170  Q
    ||||||||||||||||||||||||||||||||||||    
29184264 gaagacagaacaagatgtgtgcaattaattaatctt 29184229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University