View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_32 (Length: 376)
Name: NF20058_low_32
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 40253250 - 40253448
Alignment:
| Q |
9 |
cacatgttatatgttgaaaaagtataaggtctgaaccctaaccttataggttagttttgaaaagataaatattagtacttctaatctaaaactcaagact |
108 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253250 |
cacatgttatatgttgaaaaaatataaggtctgaaccctaaccttataggttagttttgaaaagataaatattagtacttctaatctaaaactcaagact |
40253349 |
T |
|
| Q |
109 |
agcaaagaaatacatgaccaagtaattagtacttaataattaatttatgtctaagtaaatgaaaaaaggtacaacaatttctaacaaaacatgtaaagt |
207 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253350 |
agcaaagaaattcataaccaaaaaattagtacttaataattaatttatgtctaagtaaatgaaaaaaggtacaacaatttctaacaaaacatgtaaagt |
40253448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 267 - 360
Target Start/End: Original strand, 40253454 - 40253547
Alignment:
| Q |
267 |
atatgttattgcgtttggatcattccttagaacatagactcctcaaaagtaaaatcttcttgaatcattgtttgttggtggtcaccttcataat |
360 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40253454 |
atatgctattgcgtttggatcattccatagaacatagactcgtcaaaagtaaaatcttcttgaatcattgtttgttggtggccaccttcataat |
40253547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University