View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_43 (Length: 329)
Name: NF20058_low_43
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 5829512 - 5829820
Alignment:
| Q |
1 |
gtaataatcaagattgaaatagtttgtgcttggtattgtttcatttttatgttatgtaatatgtttacaatttcaaatttcagatttgtttaagttcttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5829512 |
gtaataatcaagattgaaatagtttgtgcttggtattgtttcatttttatgttatgtaatatgtttacaatttca-------gatttgtttaagttcttg |
5829604 |
T |
 |
| Q |
101 |
gtaactcatttgatatctatcgtaaattttgtatcaataaattatgtacttgcttaaaacaatgatgtatcataaat---gatcatatttgattcccctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5829605 |
gtaactcatttgatatctatcgtaaattttgtatcaataaattatgtacttgcttaaaacaatgatgtatcataaattaagatcatatttgattcccctt |
5829704 |
T |
 |
| Q |
198 |
tgtcttaatgctgaaggaaccgttaatagacttgtcggtggtactttctggttctggagcatgattgtgctcaatcctctaatcacctgaattgtga-tt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5829705 |
tgtcttaatgctgaaggaaccgttaatagacttctcggtggtactttctggttctggagcatgattgtgctcaatcctctaatcacctgaattgtgattt |
5829804 |
T |
 |
| Q |
297 |
agaagaatgagttgtt |
312 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5829805 |
agaagaatgagttgtt |
5829820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University