View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_46 (Length: 317)
Name: NF20058_low_46
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 3722209 - 3721908
Alignment:
| Q |
1 |
ttttgattctcatcacaatatactcactctggtcacatttataagcaattttttctttaaaagaaaaacaatgcgacaccattgatttagtacctcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3722209 |
ttttgattctcatcacaatatactcactctggtcacatttataagcaattttttctttaaaagaaaaacaatgcgacaccattgatttagtacctcttca |
3722110 |
T |
 |
| Q |
101 |
gaagcattaaaactgaacaactaatgaaaaactttgcataaagtttcattctcgagagttctagcaaacatcataacatattaatgttaaaattgaattc |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3722109 |
gaagcattaaaactgaacagctaatgaaaaactttgcataaagtttcattctcgagagttctagcaaacatcataacatattaatgttaaatttgaattc |
3722010 |
T |
 |
| Q |
201 |
attattaataactaacattggaattttatttaatagtagtatgttactcttgtgcagattgtgagtggaaggcactggcaggtgatatatgtgttgcttc |
300 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
3722009 |
attattaataactaactttggaattttatttaatagtagtatgttactcttgtgcagattgtgagtggaaggcgctggtaggtgatatatgtgttgcttc |
3721910 |
T |
 |
| Q |
301 |
at |
302 |
Q |
| |
|
|| |
|
|
| T |
3721909 |
at |
3721908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 48
Target Start/End: Complemental strand, 42627524 - 42627496
Alignment:
| Q |
20 |
atactcactctggtcacatttataagcaa |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42627524 |
atactcactctggtcacatttataagcaa |
42627496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University