View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_51 (Length: 291)
Name: NF20058_low_51
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 3722466 - 3722199
Alignment:
| Q |
20 |
tttgtggactttgtatcgttctttactcgttattaatgagtaaaacaatcattattaattgaatgatttttctgactaattttacatacaatatttaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
3722466 |
tttgtggactttgtatcgttctttactcgttattaatgagtaaaacaatcattattaattgaatgatttttctgactaattttacacataatatttaatt |
3722367 |
T |
|
| Q |
120 |
ctttgatagattaatagcagtttaattttataatgtcaggtatgtgctgcataaatatgcgaatgaagatgtttcattgggatcatggttcataggctta |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3722366 |
ctttgatagattaatagtagtttaattttataatgtcagggatatgctgcataaatatgcgaatgaagatgtttcattgggatcatggttcataggctta |
3722267 |
T |
|
| Q |
220 |
aatgtggagcatgttaatgatggaagaatgtgttgtggtacaccccctggtatgttcctttgcttctc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
3722266 |
aatgtggagcatgttaatgatggaagaatgtgttgtggtacaccccctggtatgttcttttgattctc |
3722199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University