View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_55 (Length: 275)
Name: NF20058_low_55
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 15 - 259
Target Start/End: Complemental strand, 12456019 - 12455774
Alignment:
| Q |
15 |
acagacccaacccc-tgagcaaaacgtcactgaagatcaacgacagcatgatctcaactaaacattgattcgcatatcacggcgatatacattcctactt |
113 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12456019 |
acagacccaactccatgagcaaaacgtcactgaagatcaacgactgcatgatctcaactaaacattgattcgcatatcacggcgatatacattccgactt |
12455920 |
T |
 |
| Q |
114 |
ataactttctcaacagactttcccaccattttacctcggcagttcagttgtattaggactttccttccaccggaagcaaggtgcccactattcatcatat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12455919 |
ataactttctcaacagactttcccaccattttacctgggcagttcaattgtattaggactttccttccaccggaagcaaggtgcccactattcatcatat |
12455820 |
T |
 |
| Q |
214 |
ctctcactcacctcaaattctagttgactcagagtgttggagtgtg |
259 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12455819 |
ctctcactcacctcaaattcttgttgactcagagtgttggagtgtg |
12455774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University