View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_61 (Length: 263)
Name: NF20058_low_61
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 25483296 - 25483529
Alignment:
| Q |
16 |
atatcataccaaggtatatttaaccaggcccctcttttaatgnnnnnnnnnnnnnnngtcacaacctaaacaaatatgttttctcatgaattagttatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25483296 |
atatcataccaaggtatatttaaccaggcccctcctttaatgtttttttttttttttgtcacaacctaaacaaatatgttttctcatgaattagttatta |
25483395 |
T |
 |
| Q |
116 |
tactaacggagccgtgtcatatgtgaagatcaccagtcaccacaaagaattattatttcaccttttgttgttaaagttatgatatannnnnnngacaaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25483396 |
tactaacggagccgtgtcatatgtgaagatcaccagtcaccacaaagaattattatttcaccttttgttgttaaagttatgatatatttttttgacaaac |
25483495 |
T |
 |
| Q |
216 |
taaagttatgatataataatagtttgtttttaat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25483496 |
taaagttatgatataataatagtttgtttttaat |
25483529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University