View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_63 (Length: 261)
Name: NF20058_low_63
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 144 - 211
Target Start/End: Complemental strand, 12487626 - 12487559
Alignment:
| Q |
144 |
cagtgaattttttgttattaattatatcattgattaatgaaatgattttcggccttaaatcatgtcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
12487626 |
cagtgaattttttgttattaattatatcattgattaatgaaatgattttcgggcttaaatcatatcta |
12487559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 12487722 - 12487661
Alignment:
| Q |
48 |
gtcagatgaaattggatgat-acatgggactttaaaatgtttttaactttatacgttccttt |
108 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
12487722 |
gtcagatgaaattggatgattacatgtgactttaaaatgtttttaactttatatgttccttt |
12487661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University