View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20058_low_75 (Length: 238)

Name: NF20058_low_75
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20058_low_75
NF20058_low_75
[»] chr1 (1 HSPs)
chr1 (18-215)||(23406626-23406823)


Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 23406626 - 23406823
Alignment:
18 aatatatggtaaaaaatattcgaatcttgcaacattttcaggtcattaattggatattgtttactcttaatggcttgtttagactagtgattctatcata 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23406626 aatatatggtaaaaaatattcgaatcttgcaacattttcaggtcattaattggatattgtttactcttaatggcttgtttagactagtgattctatcata 23406725  T
118 aaacctggagctatgttgtgctgtggaggtgcagatgaggatttaaccactttagctgcaaatcattacagttcagcagctataggggctaacgcgta 215  Q
    ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
23406726 aaacctggagctatgttgtgctgtggaggtgcagacgaggatttgaccactttagctgcaaatcattacagttcagcagctataggggctaacgcgta 23406823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University