View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_80 (Length: 224)
Name: NF20058_low_80
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 38 - 215
Target Start/End: Original strand, 53983780 - 53983958
Alignment:
| Q |
38 |
atctatctcaatttaaatggagtcctaacatgcacccccgaccctttccaaaatgttcaagttctagtggatcttatacatcttttgttgcgaaattggc |
137 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53983780 |
atctatctcaatttaaatggagtccttacatgcacccccgaccctttccaaaatgttcaagttctagtggatcttatacatcttttgttgtgaaattggc |
53983879 |
T |
|
| Q |
138 |
tgtttga-nnnnnnnnnnnnnnagattgaaataatccttgcagttggatccagataatttcatgctcactctctctgct |
215 |
Q |
| |
|
||||| | |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53983880 |
tgttttattttttattttttttagattgaaataatccttgtagttggatccagataatttcatgctcactctctttgct |
53983958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University