View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20058_low_85 (Length: 205)
Name: NF20058_low_85
Description: NF20058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20058_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 3471868 - 3472042
Alignment:
| Q |
18 |
ttcttactaatatgtttattttgcatctcgatcttgattatgttgatttccc---gtatcaatataagtgaaattgatagtagaggtagtagtgattctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3471868 |
ttcttactaatatgtttattttgcatctcgatcttgattatgttgatttcttcttgtattaatataagtgagattgatagtagaggtagtagtgattctt |
3471967 |
T |
 |
| Q |
115 |
aacgaaatggttattttttataacgtgaaggaaatagatgggaacaaattgtaacaaagtcaaagggccaaaatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3471968 |
aacgaaatggttattttttataacgtgaagcaaatagatgggaacaaattgtaacaaagtcaaagggccaaaatg |
3472042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University