View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2005_high_4 (Length: 291)
Name: NF2005_high_4
Description: NF2005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2005_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 239
Target Start/End: Original strand, 584636 - 584859
Alignment:
| Q |
16 |
catatgtgagattgttgattgcatttgatgcaggctgatgataatgaagatagaaaattgacactcgatgagatgctagatcatgaatttgctttcttta |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
584636 |
catatgtgagattgttgattgtatttgatgcaggctgatgataatgaagatagaaaattgacactcgatgagatgctagatcatgaatttgctttcttta |
584735 |
T |
|
| Q |
116 |
acacagttcatgcagatggtcatgtggaaattgatgatgatgatcatgatgagctatgattagaaatcattgtttgacatgtataaatgaagtagcgaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
584736 |
acacagttcatgcagatggtcatgtggaaattgatgatgatgatcatgatgagctatgattagaaatcattgtttgacatgtataaatgaagtagcgaac |
584835 |
T |
|
| Q |
216 |
tagttcttcctgattttggttttg |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
584836 |
tagttcttcctgattttggttttg |
584859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University