View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2005_low_11 (Length: 231)
Name: NF2005_low_11
Description: NF2005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2005_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 44802126 - 44801912
Alignment:
| Q |
1 |
aatataatgggataataaattatcttaaaaagttaaccgccattgatacttggttgcaaatatcaccaagaccaggtgcccagccttatcctgaacttca |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44802126 |
aatataatgggatcataaattatcttaaaaagttaaccgccattgatacttggttgcaaatatcacgaagaccaggtgcccagccttatcctgaacttca |
44802027 |
T |
|
| Q |
101 |
ttctgatgcttcgccaagctctttcatccatttgatatacaaatcacttcacttataaattgctcaacacctacaccttcattataaaacttcttactca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802026 |
ttctgatgcttcgccaagctctttcatccatttgatatacaaatcacttcacttataaattgctcaacacctacaccttcattataaaacttcttactca |
44801927 |
T |
|
| Q |
201 |
aattcataccccatc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44801926 |
aattcataccccatc |
44801912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University