View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20060_high_15 (Length: 246)
Name: NF20060_high_15
Description: NF20060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20060_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 72 - 232
Target Start/End: Complemental strand, 22382548 - 22382386
Alignment:
| Q |
72 |
gtagtagaaaatggaattaagattattttgggttacatgatatgaaattaagattcgttccttaattcggtgtatgatgcaagccggatattcttaaaat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22382548 |
gtagtagaaaatggaattaagattattttgggttacataatatgaaattaagattcgttccttaattcggtgtatgatgcaagccggatattcttaaaat |
22382449 |
T |
 |
| Q |
172 |
gaaattattg--nnnnnnnnaataaactattaattgactatctctcattttgcactccatatt |
232 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22382448 |
gaaattattgttttttttttaataaactattaattgactatctctcattttgcactccatatt |
22382386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University