View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20060_low_19 (Length: 218)
Name: NF20060_low_19
Description: NF20060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20060_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 4487528 - 4487407
Alignment:
| Q |
1 |
ttaccttctcctctttgttcttcgctcatagtgagtatcaannnnnnnnnatcattgggaatcaaacttggtactccgcggtttacaacactcgcacaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4487528 |
ttaccttctcctctttgttcttcgctcatagtgagtatcaatttttttt-atcattgggaatcaaacttggtactccgcggtttacaacactcgcacaca |
4487430 |
T |
 |
| Q |
101 |
ctgcacatgaaccactttcgtta |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4487429 |
ctgcacatgaaccactttcgtta |
4487407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 121 - 218
Target Start/End: Complemental strand, 30877931 - 30877834
Alignment:
| Q |
121 |
ttattccattgtttccaaggtggactcctgtgtttggttccaacaaacagctctccatggtcatttttgttctttctttgctatggaaatggaaggtt |
218 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| || ||||||| |||||| | |||||| | || | ||||||||||||||||||||||| |
|
|
| T |
30877931 |
ttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaaatggaaggtt |
30877834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University