View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20060_low_8 (Length: 390)
Name: NF20060_low_8
Description: NF20060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20060_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 61 - 375
Target Start/End: Complemental strand, 47287005 - 47286691
Alignment:
| Q |
61 |
ccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcataattttcg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47287005 |
ccctctagcaatcaaggagaatgggaactaatacaaccaaccattggcatttcagctatgcacatgcaactttcacacaacaataaaatcataattttcg |
47286906 |
T |
|
| Q |
161 |
atcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctcactc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286905 |
atcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctcactc |
47286806 |
T |
|
| Q |
261 |
tgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctgttctctcaaacggtacattagtc |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286805 |
tgttctatacgacattgccacaaatacattccgatccttaactgtacaaacagacacttggtgttcctcaggttctgttctctcaaacggtacattagtc |
47286706 |
T |
|
| Q |
361 |
caaaccggtggtttc |
375 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47286705 |
caaaccggtggtttc |
47286691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University