View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20061_high_12 (Length: 358)
Name: NF20061_high_12
Description: NF20061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20061_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 227 - 354
Target Start/End: Original strand, 38015464 - 38015591
Alignment:
| Q |
227 |
aaatgttcacatattatatattttcctttattaatgacagaaacaaacagaagccaagcacatacctttttcttcgtaatgaggtaatcaaactcgagca |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
38015464 |
aaatgttcacatattatatattttcctttattaatgacagaaacaaacagaagacaagcacatacctttttcttcgtaatgaggtaatcaaactccatca |
38015563 |
T |
 |
| Q |
327 |
atgtcaggctaaccagttcatctcactc |
354 |
Q |
| |
|
||||||||||||| | ||||||| |||| |
|
|
| T |
38015564 |
atgtcaggctaactaattcatctaactc |
38015591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 38015348 - 38015429
Alignment:
| Q |
20 |
tttcataggacactttgcagaagaaataatgttccacgcttcgacccaatattaatgaagtgcaattgtttcatgagcacaa |
101 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38015348 |
tttcataggacactttgcagaagaactaatgtttcacacttcgacccaatattaatgaagtgcaattctttcatgagcacaa |
38015429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University