View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20061_high_17 (Length: 275)
Name: NF20061_high_17
Description: NF20061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20061_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 6935106 - 6934840
Alignment:
| Q |
1 |
gatgctgaaactacaagattaacatgtttgagtttttagtattgtagataatcacatagtgctagcaaatcccttttttggtctctttaacgttaatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6935106 |
gatgctgaaactacaagattaagatgttcgaggttttagtattgtagataatcacatagtgctagcaaatcccttttttggtctctttaacgttaatcaa |
6935007 |
T |
|
| Q |
101 |
cttataaaggcttcttacaagtgaagttgtttt-aaaagctttttaatagtgctcatttgaactgaaggaagg-aagccagggagttgatcttgcacatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6935006 |
cttataaaggcttcttacaagtgaagttgttttaaaaagctttttaatagtgctcatttgaactgaaggaaggaaagccagggagttgatcttgcacatt |
6934907 |
T |
|
| Q |
199 |
gaaaagcataatttgtatcagacatgctcaaagctttataccaatggtaagtgctcacagtattctt |
265 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
6934906 |
gaaaggcataatttgtatcagacatgctcaaagctttataccaatggtaagtgctaatagtattctt |
6934840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 6526258 - 6526299
Alignment:
| Q |
168 |
gaaggaagccagggagttgatcttgcacattgaaaagcataa |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6526258 |
gaaggatgccagggagttgatcttgcacattcaaaggcataa |
6526299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 168 - 209
Target Start/End: Original strand, 6843036 - 6843077
Alignment:
| Q |
168 |
gaaggaagccagggagttgatcttgcacattgaaaagcataa |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6843036 |
gaaggatgccagggagttgatcttgcacattcaaaggcataa |
6843077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 102
Target Start/End: Complemental strand, 6935135 - 6935107
Alignment:
| Q |
74 |
ttttttggtctctttaacgttaatcaact |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6935135 |
ttttttggtctctttaacgttaatcaact |
6935107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University