View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20061_low_21 (Length: 251)
Name: NF20061_low_21
Description: NF20061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20061_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 25581382 - 25581610
Alignment:
| Q |
1 |
atatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaatagagtcgccnnnnnnnncaatgcttggaactac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25581382 |
atatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaatagagtcgccttttttttcaatgcttggaactac |
25581481 |
T |
|
| Q |
101 |
ccaaccgaccctctaccatccttcaattcacctaattgattatccctgtctttcaattcaatccttcaatgacattttctatactatacttcgtacagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25581482 |
ccaaccgaccctctaccatccttcaattcacctaattgattatccctgtctttcaatttaatccttcaatgacattttctatactatacttcgtacagca |
25581581 |
T |
|
| Q |
201 |
cagcacatattatgactttcatgcctttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25581582 |
cagcacatattatgactttcatgcctttc |
25581610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 42895470 - 42895401
Alignment:
| Q |
1 |
atatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga |
70 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42895470 |
atatctccgtcattatgctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga |
42895401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University