View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20061_low_21 (Length: 251)

Name: NF20061_low_21
Description: NF20061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20061_low_21
NF20061_low_21
[»] chr1 (1 HSPs)
chr1 (1-229)||(25581382-25581610)
[»] chr7 (1 HSPs)
chr7 (1-70)||(42895401-42895470)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 25581382 - 25581610
Alignment:
1 atatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaatagagtcgccnnnnnnnncaatgcttggaactac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||    
25581382 atatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaatagagtcgccttttttttcaatgcttggaactac 25581481  T
101 ccaaccgaccctctaccatccttcaattcacctaattgattatccctgtctttcaattcaatccttcaatgacattttctatactatacttcgtacagca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
25581482 ccaaccgaccctctaccatccttcaattcacctaattgattatccctgtctttcaatttaatccttcaatgacattttctatactatacttcgtacagca 25581581  T
201 cagcacatattatgactttcatgcctttc 229  Q
    |||||||||||||||||||||||||||||    
25581582 cagcacatattatgactttcatgcctttc 25581610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 42895470 - 42895401
Alignment:
1 atatctccttcattattctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga 70  Q
    |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
42895470 atatctccgtcattatgctcaactgtctcaattactcttgcatttatgtgatttaaatggtcttaataga 42895401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University