View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20061_low_22 (Length: 251)
Name: NF20061_low_22
Description: NF20061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20061_low_22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 46 - 251
Target Start/End: Original strand, 2511748 - 2511955
Alignment:
| Q |
46 |
aaatataatggttgttctaaaccaaacatgaaaaat-tcaaaccaatttattggttttgtttggatcttgagatcattgattt-agttcttaccactttt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2511748 |
aaatataatggttgttctaaaccaaacatgaaaaaaatcaaaccaatttattggttttgtttggatcttcagatcattgattttagttcttaccactttt |
2511847 |
T |
|
| Q |
144 |
agaataaagataatttgttcaaaataggatttgacaaagtcattagttcaaatttgagtcccccacatgacaaacactatagcacaagagaggcattgaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2511848 |
agaataaagataatttgttcaaaataggatttgacaaagtcattagttcaaatttgagtcccccacatgacaaatagtatagcacaagagaggcattgaa |
2511947 |
T |
|
| Q |
244 |
agctataa |
251 |
Q |
| |
|
|||||||| |
|
|
| T |
2511948 |
agctataa |
2511955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University