View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20061_low_24 (Length: 222)
Name: NF20061_low_24
Description: NF20061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20061_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 32602786 - 32602944
Alignment:
| Q |
18 |
aattctagtttggacaatgttaaatcaagctttaatttgatttaaagatgaaccttgcaaagtgtgacaaactagttgtaagggacaaaaattcgtccac |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32602786 |
aattctagtttggacaatgttaaatcatgctttaatttgatttaaagatgaaccttgcaaagtgtgacaaactagttgtaagggacaaaaattcgtccac |
32602885 |
T |
 |
| Q |
118 |
taattaatatggccccatgctttcaaattgtcggattccaattattttttccagtaaca |
176 |
Q |
| |
|
|||| |||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32602886 |
taataaatatggccccatggttccaaattgtcggattccaattattttttccagtaaca |
32602944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University