View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20061_low_6 (Length: 525)
Name: NF20061_low_6
Description: NF20061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20061_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 482; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 482; E-Value: 0
Query Start/End: Original strand, 13 - 510
Target Start/End: Original strand, 47481713 - 47482210
Alignment:
| Q |
13 |
tcatattcaacaccgatttcgtcgaggaagaggtgagctggtttgcgtacaaccatggcggagaagagctggccaccgagccatgcaccaccaccagggc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47481713 |
tcatattcaacaccgatttcgtcgaggaagaggtgggctggtttgcgtacaaccatggcggagaagagctggccaccgagccatgcaccaccaccagggc |
47481812 |
T |
 |
| Q |
113 |
tgacggattgttcgatgatggcaatactgatgtttgggtttttggataattcgtaagcgcaggaaagaccagcggaaccggcaccgacgatgacgacgtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
47481813 |
tgacggattgttcgatgatggcaatactgatgtttgggtttttggataattcgtaagcgcaggaaagaccggcggaaccggcaccgactatgacgacgtc |
47481912 |
T |
 |
| Q |
213 |
ggtgtcggcgtaggtgatcatgtctgtcatgtaacgacgggtcatttcacgagagacgatggattctttgatgggtgcgaatttgaagctgtttatatcg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47481913 |
ggtgtcggcgtaggtgatcatgtctgtcatgtaacgacgggtcatttcacgagagacgatggattctttgatgggtgcgaatttgaaggtgtttatatcg |
47482012 |
T |
 |
| Q |
313 |
taagggggtgtggttagtgacatggtgattttttggggggtggatttgatgatggtggaggtgcgggtagcaattggtcttccattgaagaatgaggatt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47482013 |
taagggggtgtggttagtgacatggtgattttttggggggtggatttgatgatggtggaggtgcgggtagcaattggtcttccattgaagaatgaggatt |
47482112 |
T |
 |
| Q |
413 |
tgggagttgaagatagggaagtggcgagagatgcagtggccatggatgccattaggggtattttgggaagagaagaggtttagtgagagttgatatat |
510 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47482113 |
tgggagttgaagatagggaagtggcgagagatgcagtggccatggatgccattaggggtattttgggaagagaagaggtttagtgagagttgatatat |
47482210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University