View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20062_low_19 (Length: 217)
Name: NF20062_low_19
Description: NF20062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20062_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 62 - 198
Target Start/End: Complemental strand, 7658385 - 7658249
Alignment:
| Q |
62 |
ctcatttcttcttcttttcttctcttgccaacatcaccaattcaacatctcatttcttcacataacactgcagcttgaagtattttcatcattgaaaaag |
161 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7658385 |
ctcatttctacttcttttcttctcttgccaacatcacgaattcaacatctcatttcttcacataacactgcagcttgaagtattttcatcattgaaaaag |
7658286 |
T |
 |
| Q |
162 |
ttggagtatggatcatgaggatgttgaggtggaggag |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7658285 |
ttggagtatggatcatgaggatgttgtggtggaggag |
7658249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 118 - 198
Target Start/End: Complemental strand, 7652904 - 7652824
Alignment:
| Q |
118 |
ttcacataacactgcagcttgaagtattttcatcattgaaaaagttggagtatggatcatgaggatgttgaggtggaggag |
198 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||| ||| |||||||||| |
|
|
| T |
7652904 |
ttcacataacagtgcagtttgaagtattttcatcattgaaatagttggagtattgatcatgaggatattgtggtggaggag |
7652824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University