View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20063_high_12 (Length: 241)
Name: NF20063_high_12
Description: NF20063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20063_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 48 - 224
Target Start/End: Original strand, 34932858 - 34933034
Alignment:
| Q |
48 |
aagtaagagacattcaaacttgattgcttgtagagtcaccttttcacagcaagacaagattagtgtgcaaggataatgcattataactttgctcactttt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932858 |
aagtaagagacattcaaacttgattgcttgtagagtctccttttcacagcaagacaagattagtgtgcaaggataatgcattataactttgctcactttt |
34932957 |
T |
 |
| Q |
148 |
ttaacttgatattgatttcagtcctttacattgttgttatttgaacttaattttcgtgtttcagttgcatctattat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932958 |
ttaacttgatattgatttcagtcctttacattgttgttatttgaacttaattttcgtgtttcagttgcatctattat |
34933034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University