View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20063_high_8 (Length: 356)

Name: NF20063_high_8
Description: NF20063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20063_high_8
NF20063_high_8
[»] chr4 (1 HSPs)
chr4 (7-256)||(35234994-35235243)


Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 256
Target Start/End: Complemental strand, 35235243 - 35234994
Alignment:
7 ccactgaacgcaacaccgtatagctcttcatatgcggcggcgatttcatcttcggctgcgtctgggccgttgtctatggaaggtggtggaatgaagcctt 106  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||    
35235243 ccactgtacgcaacaccgtatagctcttcatatgcggcggcgatttcatcttcgtcttcgtctgggccgtcgtctatggaaggtggtggaatgaagcctt 35235144  T
107 ccgggatttccggtgggttgaagggaaggtcttcttctgggatggtgatgtcgaattcatcggaggtgggaattgctttgacggtgaaggaaattgtgga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35235143 ccgggatttccggtgggttgaagggaaggtcttcttctgggatggtgatgtcgaattcatcggaggtgggaattgctttgacggtgaaggaaattgtgga 35235044  T
207 gagagaaaatggggttttagtaagagggaatgtgagtttgtgggttgtgg 256  Q
    |||||  ||||||||||||||||| |||||||||||||||||||||||||    
35235043 gagagtgaatggggttttagtaagtgggaatgtgagtttgtgggttgtgg 35234994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University