View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20063_high_8 (Length: 356)
Name: NF20063_high_8
Description: NF20063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20063_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 7 - 256
Target Start/End: Complemental strand, 35235243 - 35234994
Alignment:
| Q |
7 |
ccactgaacgcaacaccgtatagctcttcatatgcggcggcgatttcatcttcggctgcgtctgggccgttgtctatggaaggtggtggaatgaagcctt |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35235243 |
ccactgtacgcaacaccgtatagctcttcatatgcggcggcgatttcatcttcgtcttcgtctgggccgtcgtctatggaaggtggtggaatgaagcctt |
35235144 |
T |
|
| Q |
107 |
ccgggatttccggtgggttgaagggaaggtcttcttctgggatggtgatgtcgaattcatcggaggtgggaattgctttgacggtgaaggaaattgtgga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35235143 |
ccgggatttccggtgggttgaagggaaggtcttcttctgggatggtgatgtcgaattcatcggaggtgggaattgctttgacggtgaaggaaattgtgga |
35235044 |
T |
|
| Q |
207 |
gagagaaaatggggttttagtaagagggaatgtgagtttgtgggttgtgg |
256 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35235043 |
gagagtgaatggggttttagtaagtgggaatgtgagtttgtgggttgtgg |
35234994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University