View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20063_low_11 (Length: 253)
Name: NF20063_low_11
Description: NF20063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20063_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 34932513 - 34932753
Alignment:
| Q |
13 |
attatactgaggacattagtaacatggaggagataactgtcaactgacatggttttttggcttacatgtgaagaaaaatcatgtgatgtacataaagnnn |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932513 |
attataccgaggacattagtaacatggaggagataactgtcaactgacatggttttttggcttacatgtgaagaaaaatcatgtgatgtacataaagaaa |
34932612 |
T |
 |
| Q |
113 |
nnnntgcactgatctggctttattaggatatggtacatgactttaagcagccttagcattactccaatttcatttcctgcaaaaatatattttcactgta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34932613 |
aaaatgcactgatctggctttattaggatatggtacatgactttaagcagccttagcattactccaatttcatttcctgcaaaaatatatttttactgta |
34932712 |
T |
 |
| Q |
213 |
tttaaagagaacatattaatatctcaatgcactattttaga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34932713 |
tttaaagagaacatattaatatctcaatgcactattttaga |
34932753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University