View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20063_low_7 (Length: 362)
Name: NF20063_low_7
Description: NF20063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20063_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 187 - 352
Target Start/End: Original strand, 581580 - 581745
Alignment:
| Q |
187 |
aaaaggaccccacgagcaccaaatatatagtgcatacttgatttatttatttccccatactaatacttacctaactactaagactgaaattaacaacaac |
286 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
581580 |
aaaagggccccacgagcaccaaatatatagtgcatacttgatttatttatccccccatactaatacttacctaactactaagactgaaattaacaacaac |
581679 |
T |
 |
| Q |
287 |
taattatgattttctctcatgatgcatgatttattcatgttgttctcttagcttcatgtgcctttg |
352 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
581680 |
taattatgattttctctcacgatgcatgatttattcatgttgttctcttagcttcatgtgcctttg |
581745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 581416 - 581475
Alignment:
| Q |
18 |
agaaattggacaaatgcaacacgtacgtggaattcaatcatgaacaaattaaatacaacg |
77 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
581416 |
agaaattggactaatgcaacacgtacgtggaattcaatcatgaacaaattaaatacaacg |
581475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University