View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20063_low_9 (Length: 292)
Name: NF20063_low_9
Description: NF20063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20063_low_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 16 - 292
Target Start/End: Complemental strand, 14703745 - 14703469
Alignment:
| Q |
16 |
ctttcttccttgtcatatatgcagaagagtgagctttcttattcattcattcactcaaatggtgtcctttccaagatggaatttcttggtacctttcttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703745 |
ctttcttccttgtcatatatgcagaagagtgagctttcttattcattcattcactcaaatggtgtcctttccaagatggaatttcttggtacctttcttc |
14703646 |
T |
 |
| Q |
116 |
cacggtatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcattaaaattgtcaagtactgctagattacaaaaacaggtagggttttc |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703645 |
cacggaatccttgttcttcttcattcacctgaaaagtgatattgatgcagtcattaaaattgtcaagtactgctagattacaaaaacaggtagggttttc |
14703546 |
T |
 |
| Q |
216 |
tatggaaattacatgtcatgaaagtgacttgctagacataacaagattattttgtgtcattttatattagtattatc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703545 |
tatggaaattacatgtcatgaaagtgacttgctagacataacaagattattttgtgtcattttatattagtattatc |
14703469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University