View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20064_low_15 (Length: 256)
Name: NF20064_low_15
Description: NF20064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20064_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 235
Target Start/End: Complemental strand, 37800078 - 37799855
Alignment:
| Q |
12 |
tagcaaaggagagaagcagttcagaacaaaagtgagtataatagggacaatgcaacatgttaatcttgttcgcctccgtggattttgctcaaaaggtacc |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37800078 |
tagccaaggagagaagcagttcagaacaaaagtgagtataatagggacaatgcaacatgttaatcttgttcgcctccgtgggttttgctcaaaaggtacc |
37799979 |
T |
|
| Q |
112 |
aaaaggttgctggtttatgattatatgccaaatcgttccttggatttccatttgtttgggaacaatagttctgaggtgttgggttggaaaatgagatacc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37799978 |
aaaaggttgctggtttatgattatatgccaaatcgttccttggatttccatttgtttgggaacaatagttctgaggtgttgggttggaaaatgagatacc |
37799879 |
T |
|
| Q |
212 |
aaattgctcttggaattgctagag |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37799878 |
aaattgctcttggaattgctagag |
37799855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 37765665 - 37765886
Alignment:
| Q |
12 |
tagcaaaggagagaagcagttcagaacaaaagtgagtataatagggacaatgcaacatgttaatcttgttcgcctccgtggattttgctcaaaaggtacc |
111 |
Q |
| |
|
|||| ||||||| || || ||||||||| ||||||||| ||||||||| ||||||||||||| |||||||| ||||| ||||| || ||| ||||||| |
|
|
| T |
37765665 |
tagccaaggagaaaaacaattcagaacagaagtgagtactatagggacagtgcaacatgttaaccttgttcgtctccgaggattctgttcagaaggtact |
37765764 |
T |
|
| Q |
112 |
aaaaggttgctggtttatgattatatgccaaatcgttccttggatttccatttgtt-tgggaacaata--gttctgaggtgttgggttggaaaatgagat |
208 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||| ||||||||||||||||||| || | | || || | |||| ||||||||| |||||| |||||| |
|
|
| T |
37765765 |
aaaaggatgctggtttatgattacatgcctaatggttccttggatttccatttattcttgaaaaaagactcttctaaggtgttggactggaaactgagat |
37765864 |
T |
|
| Q |
209 |
accaaattgctcttggaattgc |
230 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
37765865 |
accaaattgctattggaattgc |
37765886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University