View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20065_low_8 (Length: 278)
Name: NF20065_low_8
Description: NF20065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20065_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 33250750 - 33250500
Alignment:
| Q |
1 |
agttcgtaaattaatagatattttttaattaaattgttattttgcatatttgatgattaaatcatgccaccacccatgtcacaaaaacattcttgcagga |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33250750 |
agttcgtaaattgatagatattttttaattaaattgttattttgcatatttgatgattaaatcatg------------tcacaaaaacattcttgcagga |
33250663 |
T |
 |
| Q |
101 |
gaaggtttatggtttggaggagttgcaggacatgttcatggaaatggctgaaggattccagagtccttcaatgtattgtgggacaccatcggtggttgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33250662 |
gaaggtttatggtttggaggagttgcaggacatgttcatggaaatggctgaaggattccagagtccttcagtgtattgtgggacaccatcggtggttgat |
33250563 |
T |
 |
| Q |
201 |
gaatcctttgctaacagaggaagtgttttgacacgataattgataatataagccggcccatat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33250562 |
gaatcctttgctaacagaggaagtgttttgacacgataattgataatataagccgggccatat |
33250500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University