View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20066_low_3 (Length: 202)
Name: NF20066_low_3
Description: NF20066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20066_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 2777785 - 2777960
Alignment:
| Q |
20 |
ccatccccattttgggtccgtcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctca |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777785 |
ccatccccattttgggtccttcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctca |
2777884 |
T |
|
| Q |
120 |
attttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcaatatcactttctctgctcctcc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
2777885 |
attttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcgatatcactttcactcctcctcc |
2777960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University