View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2006_high_6 (Length: 227)
Name: NF2006_high_6
Description: NF2006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2006_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 486403 - 486595
Alignment:
| Q |
19 |
acctttaagcttctagaagaaaaaactgtccccggaatagtggataaatttggatggtgtacatgggatgcattttatcttaaggtacaccctcaaggag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
486403 |
acctttaagcttctagaagaaaaaactgtccccggaatagtggataaatttggatggtgtacatgggatgcattttatcttaaggtacaccctcaaggag |
486502 |
T |
|
| Q |
119 |
tttgggaaggtgttaaggatttatctgatggtggttgtccacctggctttgtcttgattgatgatggttggcaatctatagcccatgatgatg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
486503 |
tttgggaaggtgttaaggatttatctgatggtggttgtccacctggctttgtcttgattgatgatggttggcaatctatagcccatgatgatg |
486595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 28 - 192
Target Start/End: Complemental strand, 43639959 - 43639795
Alignment:
| Q |
28 |
cttctagaagaaaaaactgtccccggaatagtggataaatttggatggtgtacatgggatgcattttatcttaaggtacaccctcaaggagtttgggaag |
127 |
Q |
| |
|
||||||||||||||||| | || | ||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
43639959 |
cttctagaagaaaaaacaatacctgatatagttgataaatttggatggtgtacatgggatgcattttaccttaaggtggaccctcaaggagtgaaagaag |
43639860 |
T |
|
| Q |
128 |
gtgttaaggatttatctgatggtggttgtccacctggctttgtcttgattgatgatggttggcaa |
192 |
Q |
| |
|
||||||||| |||| || ||||| ||||| || | ||||| | |||||||||||||||||| |
|
|
| T |
43639859 |
gtgttaagggtttagtagaaggtgggtgtcctccaagttttgtaatcattgatgatggttggcaa |
43639795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University